[gentoo-commits] proj/sci:master commit in: sci-biology/trf-bin/, sci-biology/trf-bin/files/

[Martin Mokrejs]

commit:     a2df729d9eae2e016883572c2fbfe941184f421d
Author:     Martin Mokrejš <mmokrejs <AT> fold <DOT> natur <DOT> cuni <DOT> cz>
AuthorDate: Tue Jan 31 16:44:12 2017 +0000
Commit:     Martin Mokrejs <mmokrejs <AT> fold <DOT> natur <DOT> cuni <DOT> cz>
CommitDate: Tue Jan 31 16:44:12 2017 +0000
URL:        https://gitweb.gentoo.org/proj/sci.git/commit/?id=a2df729d

sci-biology/trf-bin: renamed to reflect it is an upstream's binary

A lot of fixes in the ebuild as well:
- install snapshot copies of HTML docs to prevent checksum errors
- properly set MY_PV version number
- fix install location
- distinguish between 32 and 64bit binaries

Package-Manager: Portage-2.3.3, Repoman-2.3.1

 sci-biology/trf-bin/files/trf.definitions.txt | 159 +++++++++++++++++
 sci-biology/trf-bin/files/trf.txt             | 176 +++++++++++++++++++
 sci-biology/trf-bin/files/trf.whatsnew.txt    | 243 ++++++++++++++++++++++++++
 sci-biology/trf-bin/metadata.xml              |   8 +
 sci-biology/trf-bin/trf-bin-4.09.ebuild       |  53 ++++++
 5 files changed, 639 insertions(+)

diff --git a/sci-biology/trf-bin/files/trf.definitions.txt b/sci-biology/trf-bin/files/trf.definitions.txt
new file mode 100644
index 0000000..ddedf76
--- /dev/null
+++ b/sci-biology/trf-bin/files/trf.definitions.txt
@@ -0,0 +1,159 @@
+   [1][trflogo.png]
+
+
+
+FASTA Format:
+
+   The FASTA format is a plain text format which looks something like
+   this:
+
+   >myseq
+   AGTCGTCGCT AGCTAGCTAG CATCGAGTCT TTTCGATCGA GGACTAGACT TCTAGCTAGC
+   TAGCATAGCA TACGAGCATA TCGGTCATGA GACTGATTGG GCTTTAGCTA GCTAGCATAG
+   CATACGAGCA TATCGGTAGA CTGATTGGGT TTAGGTTACC
+
+   The first line starts with a greater than sign ">" and contains a name
+   or other identifier for the sequence. This is the sequence header and
+   must be in a single line. The remaining lines contain the sequence
+   data. The sequence can be in upper or lower case letters. Anything
+   other than letters (numbers for example) is ignored. Multiple sequences
+   can be present in the same file as long as each sequence has its own
+   header.
+
+Table Explanation:
+
+   The summary table includes the following information:
+    1. Indices of the repeat relative to the start of the sequence.
+    2. Period size of the repeat.
+    3. Number of copies aligned with the consensus pattern.
+    4. Size of consensus pattern (may differ slightly from the period
+       size).
+    5. Percent of matches between adjacent copies overall.
+    6. Percent of indels between adjacent copies overall.
+    7. Alignment score.
+    8. Percent composition for each of the four nucleotides.
+    9. Entropy measure based on percent composition.
+
+   If the output contains more than 120 repeats, multiple linked tables
+   are produced. The links to the other tables appear at the top and
+   bottom of each table.
+
+   Note: If you save multiple linked summary table files, use the default
+   names supplied by your browser to preserve the automatic linking.
+
+Alignment Explanation:
+
+   The alignment is presented as follows:
+    1. In each pair of lines, the actual sequence is on the top and a
+       consensus sequence for all the copies is on the bottom.
+    2. Each pair of lines is one period except for very small patterns.
+    3. The 10 sequence characters before and after a repeat are shown.
+    4. Symbol * indicates a mismatch.
+    5. Symbol - indicates an insertion or deletion.
+    6. Statistics refers to the matches, mismatches and indels overall
+       between adjacent copies in the sequence, not between the sequence
+       and the consensus pattern.
+    7. Distances between matching characters at corresponding positions
+       are listed as distance, number at that distance, percentage of all
+       matches.
+    8. ACGTcount is percentage of each nucleotide in the repeat sequence.
+    9. Consensus sequence is shown by itself.
+   10. If chosen as an option, 500 characters of flanking sequence on each
+       side of the repeat are shown.
+
+   Note: If you save the alignment file, use the default name supplied by
+   your browser to preserve the automatic cross-referencing with the
+   summary table.
+
+Program Parameters:
+
+   Input to the program consists of a sequence file and the following
+   parameters:
+    1. Alignment Parameters. Weights for match, mismatch and indels. These
+       parameters are for Smith-Waterman style local alignment using
+       wraparound dynamic programming. Lower weights allow alignments with
+       more mismatches and indels. Match weight is +2 in all options here.
+       Mismatch and indel weights (interpreted as negative numbers) are
+       either 3, 5, or 7. A 3 is more permissive and a 7 less permissive
+       of these types of alignments choices.
+    2. Minimum Alignment Score. The alignment score must meet or exceed
+       this value for the repeat to be reported.
+    3. Maximum Period Size. The period size must be no larger than this
+       value for the repeat to be reported. Period size is the programs
+       best guess at the pattern size of the tandem repeat. The program
+       will find all repeats with period size between 1 and 2000.
+    4. Maximum TR array size. Specifies the longest TR array (the complete
+       repeating sequence) expected to be found in the input, in millions
+       of base pairs. Some sequences have very long TR arrays, such as
+       chromosome 18 in HG38 which has an array measuring over 5.3 million
+       base pairs.
+    5. Detection Parameters. Matching probability Pm and indel probability
+       Pi. Pm = .80 and Pi = .10 by default and cannot be modified in this
+       version of the program.
+
+Options:
+
+    1. Flanking sequence. Flanking sequence consists of the 500
+       nucleotides on each side of a repeat. Flanking sequence is recorded
+       in the alignment file. This may be useful for PCR primer
+       determination.
+    2. Masked Sequence File. The masked sequence file is a [2]FASTA format
+       file containing a copy of the sequence with every character that
+       occurred in a tandem repeat changed to the letter 'N'. The word
+       "masked" is added to the sequence description line just after the
+       '>' character.
+    3. Data File. The data file is a text file which contains the same
+       information, in the same order, as the repeat [3]table file, plus
+       consensus and repeat sequences. This file contains no labeling and
+       is suitable for additional processing, for example with a perl
+       script, outside of the program.
+
+
+
+     [4][USEMAP:buttonarrow.png]  [5]Home
+
+      [6][USEMAP:buttonarrow.png]  [7]What's New
+
+     [8][USEMAP:buttonarrow.png]  [9]Submit Page
+
+     [10][USEMAP:buttonarrow.png]   [11]Downloads
+
+
+
+     __________________________________________________________________
+
+   [12][bu.gif] Last revised February 22, 2016
+   Send any questions or comments to:
+   [13]Yozen Hernandez
+
+References
+
+   1. http://tandem.bu.edu/trf/trf.html
+   2. http://tandem.bu.edu/trf/trf.definitions.html#fasta
+   3. http://tandem.bu.edu/trf/trf.definitions.html#table
+   4. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.definitions.html#FPMap0
+   5. http://tandem.bu.edu/trf/trf.html
+   6. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.definitions.html#FPMap3
+   7. http://tandem.bu.edu/trf/trf.whatnew.html
+   8. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.definitions.html#FPMap1
+   9. http://tandem.bu.edu/trf/trf.submit.options.html
+  10. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.definitions.html#FPMap2
+  11. http://tandem.bu.edu/trf/trf.download.html
+  12. http://www.bu.edu/
+  13. javascript:spamGuard('yhernand','bu.edu')
+
+[USEMAP]
+http://tandem.bu.edu/trf/trf.definitions.html#FPMap2
+   1. http://tandem.bu.edu/trf/trf.download.html
+
+[USEMAP]
+http://tandem.bu.edu/trf/trf.definitions.html#FPMap1
+   1. http://tandem.bu.edu/trf/trf.submit.options.html
+
+[USEMAP]
+http://tandem.bu.edu/trf/trf.definitions.html#FPMap3
+   1. http://tandem.bu.edu/trf/trf.whatnew.html
+
+[USEMAP]
+http://tandem.bu.edu/trf/trf.definitions.html#FPMap0
+   1. http://tandem.bu.edu/trf/trf.html

diff --git a/sci-biology/trf-bin/files/trf.txt b/sci-biology/trf-bin/files/trf.txt
new file mode 100644
index 0000000..f75ec5f
--- /dev/null
+++ b/sci-biology/trf-bin/files/trf.txt
@@ -0,0 +1,176 @@
+   [1][trflogo.png]
+
+
+Using Command Line Version of Tandem Repeats Finder
+
+   Once the program is installed you can run it with no parameters to
+   obtain information on proper usage syntax.
+
+   If you installed the program as trf then by typing trf at the command
+   line you will see the following output:
+
+Please use: trf File Match Mismatch Delta PM PI Minscore MaxPeriod [options]
+
+Where: (all weights, penalties, and scores are positive)
+  File = sequences input file
+  Match  = matching weight
+  Mismatch  = mismatching penalty
+  Delta = indel penalty
+  PM = match probability (whole number)
+  PI = indel probability (whole number)
+  Minscore = minimum alignment score to report
+  MaxPeriod = maximum period size to report
+  [options] = one or more of the following:
+        -m        masked sequence file
+        -f        flanking sequence
+        -d        data file
+        -h        suppress html output
+        -r        no redundancy elimination
+        -l <n>    maximum TR length expected (in millions) (eg, -l 3 or -l=3 for
+ 3 million)
+
+Note the sequence file should be in FASTA format:
+
+>Name of sequence
+aggaaacctgccatggcctcctggtgagctgtcctcatccactgctcgctgcctctccag
+atactctgacccatggatcccctgggtgcagccaagccacaatggccatggcgccgctgt
+actcccacccgccccaccctcctgatcctgctatggacatggcctttccacatccctgtg
+
+
+   The program accepts a minimum of eight parameters. Options can be
+   specified to generate additional files.
+
+   The following is a more detailed description of the parameters:
+     * File: The sequence file to be analyzed in FASTA format( [2]see for
+       details). Multiple sequence in the same file are allowed.
+     * Match, Mismatch, and Delta: Weights for match, mismatch and indels.
+       These parameters are for Smith-Waterman style local alignment using
+       wraparound dynamic programming. Lower weights allow alignments with
+       more mismatches and indels. A match weight of 2 has proven
+       effective with mismatch and indel penalties in the range of 3 to 7.
+       Mismatch and indel weights are interpreted as negative numbers. A 3
+       is more permissive and a 7 less permissive. The recomended values
+       for Match Mismatch and Delta are 2, 7, and 7 respectively.
+     * PM and PI: Probabilistic data is available for PM values of 80 and
+       75 and PI values of 10 and 20. The best performance can be achieved
+       with values of PM=80 and PI=10. Values of PM=75 and PI=20 give
+       results which are very similar, but often require as much as ten
+       times the processing time when compared with values of PM=80 and
+       PI=10.
+     * Minscore: The alignment of a tandem repeat must meet or exceed this
+       alignment score to be reported. For example, if we set the matching
+       weight to 2 and the minimun score to 50, assuming perfect
+       alignment, we will need to align at least 25 characters to meet the
+       minimum score (for example 5 copies with a period of size 5).
+     * Maxperiod: Period size is the program's best guess at the pattern
+       size of the tandem repeat. The program will find all repeats with
+       period size between 1 and 2000, but the output can be limited to a
+       smaller range.
+     * -m: This is an optional parameter and when present instructs the
+       program to generate a masked sequence file. The masked sequence
+       file is a FASTA format file containing a copy of the sequence with
+       every location that occurred in a tandem repeat changed to the
+       letter 'N'. The word "masked" is added to the sequence description
+       line just after the '>' character.
+     * -f: If this option is present, flanking sequence around each repeat
+       is recorded in the alignment file. This may be useful for PCR
+       primer determination. Flanking sequence consists of the 500
+       nucleotides on each side of a repeat.
+     * -d: A data file is produced if this option is present. This file is
+       a text file which contains the same information, in the same order,
+       as the summary table file, plus consensus pattern and repeat
+       sequences. This file contains no labeling and is suitable for
+       additional processing, for example with a perl script, outside of
+       the program.
+     * -h: suppress HTML output (this automatically switches -d to ON)
+     * -l <n>: Specifies that the longest TR array expected in the input
+       is at most n million bp long. The default is 2 (for 2 million).
+       Setting this option too high may result in an error message if you
+       did not have enough availablememory. We have only tested this
+       option uo to value 29.
+     * -u: Prints the help/usage message above
+     * -v: Prints the version information
+     * -ngs: More compact .dat output on multisequence files, returns 0 on
+       success. You may pipe input in with this option using - for file
+       name. Short 50 flanks are appended to .dat output. .dat output
+       actually goes to stdout instead of file. Sequence headers are
+       displayed in output as @header. Only headers containing repeats are
+       shown.
+
+   Using recommended parameters the command line will look something like:
+   trf yoursequence.txt 2 7 7 80 10 50 500 -f -d -m
+
+   Once the program starts running it will print update messages to the
+   screen. The word "Done" will be printed when the program finishes.
+
+   For single sequence input files there will be at least two HTML format
+   output files, a repeat table file and an alignment file. If the number
+   of repeats found is greater than 120, multiple linked repeat tables are
+   produced. The links to the other tables appear at the top and the
+   bottom of each table. To view the results start by opening the first
+   repeat table file with your web browser. This file has the extension
+   ".1.html". Alignment files can be accessed from the repeat table files.
+   Alignment files end with the ".txt.html" extension.
+
+   For input files containing multiple sequences a summary page is
+   produced that links to the output of individual sequences. This file
+   has the extension "summary.html". You should start by opening this file
+   if your input had multiple sequences in the same file. Also note that
+   the output files of individual sequences will have an identifier of the
+   form ".sn." ( n an integer) embedded in the name indicating the index
+   of the sequence in the input file. The identifier is omitted for single
+   sequence input files.
+
+   For more information on the output please see [3]Table Explanation and
+   [4]Alignment Explanation.
+
+
+
+
+     [5][USEMAP:buttonarrow.png]  [6]Home
+
+      [7][USEMAP:buttonarrow.png]  [8]What's New
+
+     [9][USEMAP:buttonarrow.png]  [10]Submit Page
+
+     [11][USEMAP:buttonarrow.png]   [12]Downloads
+
+
+     __________________________________________________________________
+
+   [13][bu.gif] Last revised September 11, 2003
+   Send any questions or comments to:
+   [14]Yozen Hernandez
+
+References
+
+   1. http://tandem.bu.edu/trf/trf.html
+   2. http://tandem.bu.edu/trf/trf.definitions.html#fasta
+   3. http://tandem.bu.edu/trf/trf.definitions.html#table
+   4. http://tandem.bu.edu/trf/trf.definitions.html#alignment
+   5. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.unix.help.html#FPMap0
+   6. http://tandem.bu.edu/trf/trf.html
+   7. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.unix.help.html#FPMap3
+   8. http://tandem.bu.edu/trf/trf.whatnew.html
+   9. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.unix.help.html#FPMap1
+  10. http://tandem.bu.edu/trf/trf.submit.options.html
+  11. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.unix.help.html#FPMap2
+  12. http://tandem.bu.edu/trf/trf.download.html
+  13. http://www.bu.edu/
+  14. javascript:spamGuard('yhernand','bu.edu')
+
+[USEMAP]
+http://tandem.bu.edu/trf/trf.unix.help.html#FPMap2
+   1. http://tandem.bu.edu/trf/trf.download.html
+
+[USEMAP]
+http://tandem.bu.edu/trf/trf.unix.help.html#FPMap1
+   1. http://tandem.bu.edu/trf/trf.submit.options.html
+
+[USEMAP]
+http://tandem.bu.edu/trf/trf.unix.help.html#FPMap3
+   1. http://tandem.bu.edu/trf/trf.whatnew.html
+
+[USEMAP]
+http://tandem.bu.edu/trf/trf.unix.help.html#FPMap0
+   1. http://tandem.bu.edu/trf/trf.html

diff --git a/sci-biology/trf-bin/files/trf.whatsnew.txt b/sci-biology/trf-bin/files/trf.whatsnew.txt
new file mode 100644
index 0000000..8967a7d
--- /dev/null
+++ b/sci-biology/trf-bin/files/trf.whatsnew.txt
@@ -0,0 +1,243 @@
+   [1][trflogo.png]
+
+
+[newspaper.png] What's New?
+
+New For Version 4.09 (Feb 22, 2016)
+
+   [checkmark.png] new -l/-L flag allows the user to specify the length of
+   the longest expected TR array in the input sequence, in millions. The
+   default value is 2, for 2 million bp. For HG38, a value of 6 is
+   necessary.
+
+   Example usage:
+trf409.linux64.exe hg38.fasta 2 5 7 80 10 50 2000 -l 6
+
+   [checkmark.png] Setting a sufficiently high value may result in a
+   crash, very long execution time, or a sharp drop in available memory on
+   your system. We have only tested up to a value of 25.
+
+   [checkmark.png] For workloads requiring over 3GB of RAM (any value of
+   -l above 5), the 32-bit builds cannot be used.
+
+   [checkmark.png] New -v/-V flag allows you to quickly check your version
+   of TRF.
+
+   [checkmark.png] New -u/-U flag allows you to quickly display the usage
+   help text.
+
+
+New For Version 4.07b
+
+   [checkmark.png] new -ngs flag allows more compact output and piping of
+   input on linux systems, returns standard linux exit value of 0 on
+   success
+
+   [checkmark.png] temporary output is no longer written to disk
+
+   [checkmark.png] changed alignment to go further when score drops to 0
+   on first pass, more repeats are reported now
+
+   [checkmark.png] fixed bestlist structure deallocations, this
+   significantly improves run speed on multi-sequence fasta files
+
+   [checkmark.png] fixed line in alignment files "file K of N", K was off
+   by 1 before
+
+   [checkmark.png] Added check to make sure all required parameters are
+   entered from the commandline
+
+
+New For Version 4.04
+
+   [checkmark.png] Widened radius of narrowband alignment to avoid losing
+   alignment in some cases
+
+
+New For Version 4.03
+
+   [checkmark.png] Added -R switch to produce output without redundancy if
+   desired
+
+   [checkmark.png] Fixed a bug in the redundancy algorithm which sometimes
+   caused repeats to vanish
+
+   [checkmark.png] Fixed a bug when N characters being part of pattern
+   cause problems
+
+
+New For Version 4.00
+
+   [checkmark.png] Improved longer period detection and period 1 detection
+
+   [checkmark.png] Improved alignment
+
+   [checkmark.png] Added a flag to suppress HTML output (-h)
+
+   [checkmark.png] Fixed a loading sequence problem with incomplete FASTA
+   format files
+
+   [checkmark.png] Increased minimum period for larger repeats from 1.9 to
+   1.8 (patternsize > 50)
+
+   [checkmark.png] Added Linux GUI version (GTK+)
+
+
+New For Version 3.21
+
+   [checkmark.png] Fixed Sequence Name Bug: This bug affected the parsing
+   of FASTA header on Windows versions of the program. The bug caused the
+   program to report a sequence name that had a control character appended
+   at the end and a missing parameters line in the output data file. This
+   bug surfaced as a result of version 3.20 fixes.
+
+
+New For Version 3.20
+
+   [checkmark.png] Improved Redundancy Control: We have improved the
+   program's ability to remove redundant versions of the same tandem
+   repeat. On earlier versions certain conditions could cause the
+   algorithm to leave a redundant version in the output. The new version
+   properly identifies these and removes them.
+
+   [checkmark.png] Improved End-of-Line Identification: Different
+   operating systems use different conventions for end of line (EOL)
+   character sequence in text files. We have made improvements in the
+   routines that allows TRF to read sequence text from files using various
+   EOL conventions.
+
+   [checkmark.png] Fixed Memory Overrun Bug: We have corrected a problem
+   where some large-pattern, low-scoring repeats could cause a memory
+   fault in previous versions. Thanks to Angie Hinrichs at UC Santa Cruz's
+   Genome Bioinformatics group for the bug report and the offending
+   sequence.
+
+
+
+Previous Update (Version 3.01)
+
+   [checkmark.png] Unlimited Sequence Size: We have eliminated the
+   sequence size restriction of previous versions. In this version you are
+   only limited by the memory available in your system.
+
+   [checkmark.png] Multi-Sequence Files: The program handles files
+   containing multiple sequences. Each sequence must contain its own FASTA
+   header. A summary page is produced which links to the results of
+   individual sequences.
+
+   [checkmark.png] Data File Includes Repeat Sequence: We now include
+   complete repeat sequence for each repeat record reported in the data
+   file.
+
+   [checkmark.png] Smaller Scores: The downloadable versions of the
+   program are now able to report matches with scores as low as 20. We
+   recommend caution when using this feature since very large output files
+   can be generated at this score level.
+
+   [checkmark.png] Longer Patter Sizes: The program finds repeats with
+   period size as large as 2000 base pairs.
+
+   [checkmark.png] New File Naming Convention: For input files containing
+   a single sequence the naming convention for output files has not been
+   changed. For input files containing multiple sequences a summary page
+   is produced. This file has the extension "summary.html" and contains
+   links to the repeat tables of the individual sequences. In the name of
+   each of those repeat tables and their alignment files, an additional
+   identifier ".sn." ( n an integer, for example: ".s3.") has been
+   inserted before the parameters to indicate the sequence index in the
+   input file.
+
+   [checkmark.png] Repeat Table Changes: Each table now shows the total
+   number of repeats found in the sequence and links to other tables have
+   been added at the bottom of the page.
+
+   [checkmark.png] Longer Flanking Sequence: 500 characters of flanking
+   sequence on each side of the repeat are now reported.
+
+
+   Previous Update (Version 2.02)
+
+   [checkmark.png] Multiple Repeat Tables: If the output contains more
+   than 140 repeats, multiple linked repeat tables and alignment files
+   will be produced. This will speed downloading time and overcome
+   problems with tables too big for web browsers to format.
+
+   [checkmark.png] Consensus Sequence: The program prints the consensus
+   sequence for each repeat in the alignment file, below the alignment.
+
+   [checkmark.png] Flanking Sequence: As an option, the program prints 200
+   characters of flanking sequence from each side of the repeat. This may
+   be useful for PCR primer determination. Find it in the alignment file.
+
+   [checkmark.png] Masked Sequence File: As an option, the program returns
+   a copy of the original sequence with the tandem repeats "masked" out.
+   The masked sequence file is a [2]FASTA format file with every tandem
+   repeat character changed to the letter 'N'. The word "masked" is added
+   to the sequence description line just after the '>' character.
+
+   [checkmark.png] Data File: As an option, the program returns a text
+   file containing the same data, in the same order, as the summary table
+   file, plus consensus sequences, but without any labels or formatting
+   instructions. This file is suitable for automated processing, for
+   example with a perl script.
+
+   [checkmark.png] Select Parameters: Now you can select parameters when
+   you submit a sequence, or simply use the default parameters. Visit the
+   [3]Submit Options Page for more details.
+
+   [checkmark.png] Sequence Alphabet: The program now handles sequences
+   containing letter other than A, C, G, and T.
+
+   [checkmark.png] Enhanced Alignment File: We have modified the
+   presentation of the alignment file. The output should be easier to view
+   and print.
+
+   [checkmark.png] Automatic Redundancy Removal: The program now reports
+   only the smallest period size for a repeat unless a larger period size
+   has a significantly higher score.
+
+   [checkmark.png] Windows Version Now Available: A Windows version of the
+   program is now available for download. This version of the the program
+   can be run under Windows 95/98 and Windows NT 4. Please visit our
+   [4]Download Page for more details.
+
+
+
+
+     [5][USEMAP:buttonarrow.png]  [6]Home
+
+     [7][USEMAP:buttonarrow.png]  [8]Submit Page
+
+     [9][USEMAP:buttonarrow.png]  [10]Downloads
+     __________________________________________________________________
+
+   [11][bu.gif] Last revised February 22, 2016
+   Send any questions or comments to:
+   [12]Yozen Hernandez
+
+References
+
+   1. http://tandem.bu.edu/trf/trf.html
+   2. http://tandem.bu.edu/trf/trf.definitions.html#fasta
+   3. http://tandem.bu.edu/trf/trf.submit.options.html
+   4. http://tandem.bu.edu/trf/trf.download.html
+   5. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.whatnew.html#FPMap0
+   6. http://tandem.bu.edu/trf/trf.html
+   7. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.whatnew.html#FPMap1
+   8. http://tandem.bu.edu/trf/trf.submit.options.html
+   9. LYNXIMGMAP:http://tandem.bu.edu/trf/trf.whatnew.html#FPMap2
+  10. http://tandem.bu.edu/trf/trf.download.html
+  11. http://www.bu.edu/
+  12. javascript:spamGuard('yhernand','bu.edu')
+
+[USEMAP]
+http://tandem.bu.edu/trf/trf.whatnew.html#FPMap2
+   1. http://tandem.bu.edu/trf/trf.download.html
+
+[USEMAP]
+http://tandem.bu.edu/trf/trf.whatnew.html#FPMap1
+   1. http://tandem.bu.edu/trf/trf.submit.options.html
+
+[USEMAP]
+http://tandem.bu.edu/trf/trf.whatnew.html#FPMap0
+   1. http://tandem.bu.edu/trf/trf.html

diff --git a/sci-biology/trf-bin/metadata.xml b/sci-biology/trf-bin/metadata.xml
new file mode 100644
index 0000000..959160f
--- /dev/null
+++ b/sci-biology/trf-bin/metadata.xml
@@ -0,0 +1,8 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE pkgmetadata SYSTEM "http://www.gentoo.org/dtd/metadata.dtd">
+<pkgmetadata>
+  <maintainer type="project">
+    <email>sci-biology@g.o</email>
+    <name>Gentoo Biology Project</name>
+  </maintainer>
+</pkgmetadata>

diff --git a/sci-biology/trf-bin/trf-bin-4.09.ebuild b/sci-biology/trf-bin/trf-bin-4.09.ebuild
new file mode 100644
index 0000000..11fae9c
--- /dev/null
+++ b/sci-biology/trf-bin/trf-bin-4.09.ebuild
@@ -0,0 +1,53 @@
+# Copyright 1999-2017 Gentoo Foundation
+# Distributed under the terms of the GNU General Public License v2
+# $Id$
+
+EAPI=6
+
+inherit eutils
+
+MY_PV="${PV/.}" # drop the dot
+MY_PN="trf"
+MY_P="trf${MY_PV}"
+
+DESCRIPTION="Tandem Repeats Finder"
+HOMEPAGE="http://tandem.bu.edu/trf/trf.html"
+SRC_URI="x86? ( http://tandem.bu.edu/trf/downloads/${MY_P}.linux32 )
+	amd64? ( http://tandem.bu.edu/trf/downloads/${MY_P}.linux64 )"
+
+LICENSE="trf"	# http://tandem.bu.edu/trf/trf.license.html
+SLOT="0"
+KEYWORDS="~amd64 ~x86"
+RESTRICT="mirror bindist"
+
+S="${WORKDIR}"
+
+QA_PREBUILT="opt/${MY_PN}/.*"
+
+src_unpack() {
+	if use x86; then
+		cp "${DISTDIR}/${MY_P}".linux32 "${S}/${MY_PN}" || die
+	elif use amd64; then
+		cp "${DISTDIR}/${MY_P}".linux64 "${S}/${MY_PN}" || die
+	else
+		eerror "Unsupported platform, check http://tandem.bu.edu/trf/downloads/"
+	fi
+	default
+}
+
+src_install() {
+	exeinto /opt/"${MY_PN}"/bin
+	doexe "${MY_PN}"
+	# GTK version (http://tandem.bu.edu/trf/downloads/trf400.linuxgtk.exe) has broken linking
+	#if use gtk; then
+	#	doexe trf400.linuxgtk.exe
+	#	make_desktop_entry /opt/${PN}/trf400.linuxgtk.exe "Tandem Repeats Finder" || die
+	#fi
+	# http://tandem.bu.edu/trf/trf.unix.help.html
+	# http://tandem.bu.edu/trf/trf.definitions.html
+	# http://tandem.bu.edu/trf/trf.whatnew.html
+	dodoc \
+		"${FILESDIR}/"trf.txt \
+		"${FILESDIR}/"trf.definitions.txt \
+		"${FILESDIR}/"trf.whatsnew.txt
+}